rs17030354 chr2:43086514 T>G
- Sequence
ccaccacgcctggccaatcttttt[T/G]cattccgtccctgcatttaggcct
- ASB in cell types
- HASM2 (Human airway smooth muscle 2) A549 (lung carcinoma) macrophages form periferal blood
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.31 | 0.61 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, chronic kidney disease, diastolic blood pressure (dbp), mitral annular calcium, serum creatinine, systolic blood pressure (sbp), total cholesterol