rs17033702 chr2:67516476 C>T
- Sequence
ttgaagtccccctgatttactgta[C/T]gcaatatgttacagcttccttatt
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 1.38 | -3.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI waist-to-hip ratio adjusted for bmi (joint analysis for main effect and physical activity interaction), waist-to-hip ratio adjusted for bmi in active individuals, waist-to-hip ratio adjusted for body mass index
GRASP college completion, diastolic blood pressure (dbp), systolic blood pressure (sbp), waist hip ratio