rs17040439 chr4:109444359 A>T
- Sequence
gtgtggtaaggaatgttaaaaagt[A/T]ctctggtggtgttagtaatgaatt
- ASB in cell types
- macrophages form periferal blood CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 2.24 | 0.73 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.56 | 0.95 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, biploar disorder (bipolar schizoaffective disorder), bipolar disorder
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cortex, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Muscle_Skeletal, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid