rs17041839 chr3:16060453 C>T
- Sequence
cagcaatgaaaacaagctcaatgt[C/T]catgtcagataaacaattgtcgtc
- ASB in cell types
- ovary HUVEC-C (HUVEC, umbilical vein endothelial cells) TTC-1240 (Rhabdoid tumor of the kidney) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- NOTC1_HUMAN CTCF_HUMAN STAT3_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | 2.65 | n/a | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.25 | 0.19 | 1.43 | n/a | No Hit | |||
| STAT3_HUMAN | 2.29 | 3.00 | 1.50 | n/a | No Hit | |||
| EP300_HUMAN | 1.50 | 0.48 | 1.46 | n/a | n/a | |||
| ESR1_HUMAN | 2.41 | -4.87 | 2.00 | -0.58 | Weak Concordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid