rs17045266 chr3:66825591 C>G
- Sequence
tgcagtcacaagcagcttttctag[C/G]agaactctggacttagggttgaag
- ASB in cell types
- liver
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 1.34 | -0.82 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, barnes akathisia rating scale, refractive error, tardive dyskinesia