rs17049086 chr2:129101215 T>C
- Sequence
ctttctgggttaccttgggcaaca[T/C]tcctgctctgaacctgagttttct
- ASB in cell types
- LNCaP (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.43 | 1.18 | 1.95 | |||
| 22RV1 (prostate carcinoma) | 2.47 | -4.70 | 2.00 |
Items per page:
1 – 2 of 2