rs17053196 chr8:25199020 G>C
- Sequence
tttgaggaggtttgagcctgcaaa[G/C]tggaagtgacactgtgggttgcac
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- SPI1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.26 | -0.26 | 2.12 | -2.02 | Concordant | |||
| GCR_HUMAN | 1.27 | 0.05 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
