rs17054098 chr9:88387743 C>T
- Sequence
gcttgcagaagccacatcccgtcc[C/T]cacacaacctaggacaggccaggt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.14 | 0.91 | 1.84 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.36 | 0.89 | 1.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Colon_Transverse, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Stomach, Whole_Blood