rs17056378 chr13:37647445 G>A
- Sequence
aagaggcagctgaaaacaatgata[G/A]gatctgcaaaggctgctgagaaca
- ASB in cell types
- BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) iPS-derived chondrocytes
- ASB for transcription factors
- SMRC1_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | n/a | 2.59 | 1.00 | n/a | n/a | |||
| RARA_HUMAN | 0.42 | 1.24 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2