rs17077538 chr5:174409150 A>T
- Sequence
tttatttccttaaatagtcattgc[A/T]tactcaccctatgccagacactaa
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -2.29 | 2.67 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.63 | 2.19 | 1.00 |
Items per page:
1 – 2 of 2