rs17078779 chr13:33207759 C>G
- Sequence
acatggattgttgggtcaattctt[C/G]ccatatggtgttgcaagtctttgc
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) macrophages
- ASB for transcription factors
- TCF21_HUMAN CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.23 | n/a | 2.00 | 3.60 | Discordant | |||
| CEBPB_HUMAN | 2.76 | 0.28 | 1.75 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
