rs17081373 chr18:69637027 A>G
- Sequence
gttttagttctgaatggcagcacc[A/G]tctccccaccgccatacccctctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) thyroid gland GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.42 | 0.27 | 1.10 | |||
| thyroid gland | n/a | 2.30 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.92 | 0.92 | 1.00 |
Items per page:
1 – 3 of 3