rs17082367 chr5:92552932 G>A
- Sequence
aaactgatacattgtacccctgct[G/A]tttcaaaactgtgactgatgaaag
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma)
- ASB for transcription factors
- KDM2B_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM2B_HUMAN | 2.45 | -0.45 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | 1.52 | -0.06 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP birth weight, diabetic retinopathy in type 2 diabetes mellitus, obesity with early age of onset (age >2), total cholesterol