rs17086609 chr13:28355574 A>G
- Sequence
atctgcctcagctgttcatcccgg[A/G]gtacattccagggcagaaagcatt
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.25 | -4.71 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), intra-extradimensional set shifting, late onset alzheimers disease, ldl cholesterol, waist hip ratio
PheWAS abnormal function study of cardiovascular system, actinic keratosis, acute cystitis, acute pharyngitis, bronchopneumonia and lung abscess, cancer of other male genital organs, chronic osteomyelitis, circumscribed scleroderma, concussion, corneal dystrophy, diseases of pulp and periapical tissues, drug-resistant infection, esophageal cancer, eye infection, viral, fever of unknown origin, fractur of unspecified part of femur, fracture of ribs, fuchs dystrophy, herpes zoster with nervous system complications, intestinal infection, labyrinthitis, lesions of stomach and duodenum, lichen, liver abscess and sequelae of chronic liver disease, malunion fracture, mild cognitive impairment, nodular lymphoma, nonrheumatic aortic valve disorders, open wound of toe(s), other conditions of brain, nos, other disorders of the nervous system, other paralytic syndromes, other specified disorders of plasma protein metabolism, pancreatic cancer, periapical abscess, postnasal drip, postoperative infection, primary pulmonary hypertension, pulmonary collapse, interstitial/compensatory emphysema, purpura and other hemorrhagic conditions, rash and other nonspecific skin eruption, renal dialysis, retention of urine, scar conditions and fibrosis of skin, secondary malignant neoplasm of digestive systems, simple goiter, spinal stenosis, spinal stenosis of lumbar region, stomach cancer, subarachnoid hemorrhage (injury), thrombocytopenia, thyroid cancer, type 1 diabetic neuropathy, unspecified monoarthritis, visual field defects