rs17092197 chr14:95432270 A>G
- Sequence
catctggacagcctgagccagcag[A/G]tgattcgatttaatgagcttttta
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) OCI-LY7 (diffuse large B-cell lymphoma) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.27 | -2.42 | 1.50 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 2.27 | -2.27 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -0.52 | 1.78 | 1.00 |
Items per page:
1 – 3 of 3