rs17092267 chr14:95442735 C>T
- Sequence
gatgaagctctgtggcctccaggc[C/T]ttgtgcaggctgcaagggacccga
- ASB in cell types
- A549 (lung carcinoma) erythroid progenitors HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.39 | 0.85 | 2.00 | |||
| erythroid progenitors | 2.21 | n/a | 2.50 | |||
| HCT-116 (colon carcinoma) | 0.95 | 1.06 | 1.00 |
Items per page:
1 – 3 of 3