rs17095820 chr11:100932859 G>A
- Sequence
gatctatgctattatactttagtc[G/A]ttatcttagtggtctcttctggat
- ASB in cell types
- foreskin keratinocyte HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.02 | -4.45 | 2.67 | |||
| HUES64 (embryonic stem cells) | 2.32 | -0.09 | 1.00 |
Items per page:
1 – 2 of 2