rs17098553 chr14:32201977 A>C
- Sequence
agatggacaggaaagcgctcgatt[A/C]ggttaccgtaaggaaaacaaatga
- ASB in cell types
- HepG2 (hepatoblastoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.93 | 0.23 | 1.96 | |||
| HEK293 (embryonic kidney) | 0.33 | 0.78 | 1.51 |
Items per page:
1 – 2 of 2