rs17103212 chr14:35340038 T>C
- Sequence
ttctgtgtttatggctagaaattc[T/C]gcagcagctgcatttctcagtatc
- ASB in cell types
- MDM(monocyte derived macrophages) GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | -2.26 | 3.06 | 2.00 | 3.22 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
