rs17106322 chr10:86139197 C>T
- Sequence
ggttggaggacgccggcgtagacc[C/T]agcagcgttcaccagtgtccagcc
- ASB in cell types
- LUHMES (lund human mesencephalic cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.95 | 0.37 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, college completion, fasting blood glucose, homa-b, ldl cholesterol, mitral annular calcium, total cholesterol