rs17107825 chr14:72128602 C>T
- Sequence
agatgtttttaaaacattatatac[C/T]cttatgcccttggtgtctctgatg
- ASB in cell types
- VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | 1.11 | 0.09 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, chronic kidney disease, hdl cholesterol change with statins, ldl cholesterol change with statins, serum creatinine, total cholesterol change with statins, triglycerides, years of education