rs17112105 chr12:54428254 T>C
- Sequence
cttggctcccagctcatttccgct[T/C]ttatgcctttagtctggctctcag
- ASB in cell types
- MDM(monocyte derived macrophages)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.48 | -4.03 | 2.50 | -0.12 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Putamen_basal_ganglia, Testis, Thyroid