rs17114234 chr14:28751630 G>A
- Sequence
gctgaaggctagctagctctggtg[G/A]ctgaacaccagttgagggcagcag
- ASB in cell types
- erythroid cells SUM159PT (Triple negative breast cancer) GM12891 (male B- cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.20 | n/a | 2.00 | |||
| SUM159PT (Triple negative breast cancer) | 2.19 | -1.91 | 1.25 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 0.05 | 0.75 | 1.00 |
Items per page:
1 – 3 of 3