rs17114416 chr10:102169609 G>C
- Sequence
ccgatggggccagtaggtggcgat[G/C]ttgcccccctgtttagggagctgg
- ASB in cell types
- CD14+ monocytes HCT-116 (colon carcinoma) MS-1 (Small cell lung carcinoma) upper lobe of left lung
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.29 | -0.96 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1