rs17115384 chr14:44657931 T>G
- Sequence
ctgaacacattcacccaatgcaag[T/G]aggttttgttttttggtttggggt
- ASB in cell types
- hASC (preadipocytes) Ishikawa (endometrial adenocarcinoma) glioblastoma cells
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.84 | 0.27 | 1.29 | n/a | No Hit | |||
| RAD21_HUMAN | 0.86 | 1.26 | 1.14 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, hdl cholesterol, height, ldl cholesterol, microalbuminuria, prop taste detection threshold, total cholesterol