rs17117610 chr15:23857286 C>G
- Sequence
gaagtgaactgcttcagaaatgcc[C/G]tgggagccgctggggaaagaggtg
- ASB in cell types
- glioblastoma cells A549 (lung carcinoma) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -3.09 | 1.89 | 1.33 | |||
| A549 (lung carcinoma) | -0.57 | 1.22 | 2.57 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | 0.99 | n/a | 2.00 |
Items per page:
1 – 3 of 3