rs17121406 chr1:60979178 C>T
- Sequence
ggcgacactcacacacagcagggg[C/T]ccttaaaggctagatctcagtatc
- ASB in cell types
- MOLM-13(acute monocytic leukemia(AML), Homo sapiens) HMEC (human mammary epithelial cells) erythroid progenitors gastroesophageal sphincter
- ASB for transcription factors
- CTCF_HUMAN SMC1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.45 | 0.04 | 1.28 | n/a | No Hit | |||
| SMC1A_HUMAN | 2.94 | -3.02 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2