rs17125088 chr12:50932919 T>C
- Sequence
ccttcctctgtcatctccccagaa[T/C]tggaacctccttaatccaaccatc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.17 | 0.90 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP major depressive disorder, maternal transmission distortion, paternal transmission distortion, transmission distortion, type 2 diabetes
GTEx eQTL Brain_Cerebellum, Brain_Cortex, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Testis