rs17128050 chr14:54877161 T>C
- Sequence
ctccaacatatctaaaagctacca[T/C]ctgtaggtaataagaacagaacac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) primary endothelial colony-forming cells
- ASB for transcription factors
- TAL1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 1.91 | -2.29 | 1.50 | -0.21 | Weak Concordant | |||
| TF65_HUMAN | 1.43 | -4.56 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP diastolic blood pressure (dbp), systolic blood pressure (sbp), urinary free dopamine (nmol/d) in children, urinary free dopamine:creatinine in children
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood