rs17131332 chr1:70528912 G>A
- Sequence
gaccgtcttctgagcactgagtgc[G/A]atcatagtctcactagatggcagc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM19240 (B cells Lymphoblastoid Cell Lines) HMEC (human mammary epithelial cells) CD34+ stem cells-derived erythroblasts
- ASB for transcription factors
- CTCF_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.09 | 0.55 | 1.29 | n/a | No Hit | |||
| SPI1_HUMAN | 1.30 | 0.36 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2