rs171343 chr7:149625785 T>C
- Sequence
ctggggaacctgcgacatgtgatg[T/C]ggggtctatggggcttgccaggcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) RWPE2 MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.05 | 0.50 | 1.50 | |||
| HEK293 (embryonic kidney) | 0.16 | 0.76 | 1.96 | |||
| RWPE2 | -1.95 | 2.30 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.73 | -0.38 | 1.00 | |||
| SK-N-SH (neuroblastoma) | -1.66 | 2.61 | 2.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood