rs17136356 chr7:104267990 A>T
- Sequence
caggttatcatagaaaatgcaaag[A/T]ttagtagtgtgggaatatttggtt
- ASB in cell types
- neural progenitors hASC (preadipocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | -2.06 | 2.44 | 1.00 | |||
| hASC (preadipocytes) | 1.33 | -0.49 | 1.00 |
Items per page:
1 – 2 of 2