rs17137348 chr15:22839090 C>T
- Sequence
gaaacccaccgtgaatcggattgc[C/T]gttcagtcccacggaagcctggct
- ASB in cell types
- primary B-CLL cells LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.19 | -0.45 | 2.00 | |||
| LNCaP C4-2B (prostate carcinoma) | 1.80 | -1.39 | 1.00 |
Items per page:
1 – 2 of 2