rs17138546 chr6:797780 C>T
- Sequence
tacagccaaacgtttatccgctcc[C/T]gaggacaacattacaaccacatct
- ASB in cell types
- sigmoid colon tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| sigmoid colon | 1.81 | 0.89 | 1.00 | |||
| tibial nerve | -1.67 | 2.06 | 1.00 |
Items per page:
1 – 2 of 2