rs17144901 chr7:122803594 C>T
- Sequence
gatggtgagcttgtggcttggcag[C/T]tcatgcctctgatcattggtctct
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) foreskin keratinocyte upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 1.79 | -1.37 | 1.00 | |||
| foreskin keratinocyte | 1.24 | -4.73 | 2.67 | |||
| upper lobe of left lung | 0.19 | 2.39 | 1.00 |
Items per page:
1 – 3 of 3