rs17152355 chr7:105934756 T>C
- Sequence
ctgcttgaacagtgaagactcctg[T/C]ggggcactagatggcaacatttct
- ASB in cell types
- foreskin keratinocyte GM19238 (female B-cells lymphoblastoid cell lines) GM12878 (female B-cells lymphoblastoid cell line) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN ZN444_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.12 | 0.39 | 1.38 | n/a | No Hit | |||
| ZN444_HUMAN | 2.70 | -2.57 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, ldl cholesterol, major depressive disorder, stabilized warfarin dose, triglycerides