rs17153112 chr7:106429721 A>G
- Sequence
gtaactaggaggcctctccgaatc[A/G]tagtctctacagtcagtgccatct
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.63 | -4.96 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, birth weight, hip bone mineral density (bmd), homa-b, ldl cholesterol change with statins, mitral annular calcium, primary rhegmatogenous retinal detachment, rheumatoid arthritis, suicide attempts in bipolar disorder (substance free)