rs17156823 chr7:28536519 G>A
- Sequence
agacctgaacttccttgcattagg[G/A]tttggcagcttcacgaggcagcac
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SYO-1(Biphasic synovial sarcoma) | n/a | 3.00 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, asthma, cystatin c in serum, eye color, hdl cholesterol, neuroblastoma (brain cancer), partial epilepsy, triglycerides