rs17157903 chr7:103987589 C>T
- Sequence
tcactcacttacccaccgttctca[C/T]tgagagatcataccgggcaagaac
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | 0.36 | 1.21 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, fasting blood glucose, ldl cholesterol change with statins, multiple sclerosis, age of onset, schizophrenia, sporadic creutzfeldt-jakob disease, sporadic post-menopausal breast cancer, tetrology of fallot
PheWAS abnormal results of function studies, adverse effects of adrenal cortical steroids, adverse effects of hormones and synthetic substitutes, allergic reaction to food, anomalies of jaw size/symmetry, atopic or contact dermatitis, bipolar, blister, cancer of other female genital organs, costochondritis, deep vein thrombosis, dementia with cerebral degenerations, diseases of the larynx and vocal cords, diseases of white blood cells, disorders of sweat glands, disorders of tooth development, disturbances in tooth eruption, diverticulum of esophagus, acquired, dyshidrosis, elevated blood pressure reading, encounter for long-term use of anticoagulants/antithrombotics, encounter for long-term use of aspirin, eosinophilia, functional digestive disorders, gastrointestinal complications, gout, gout and other crystal arthropathies, hearing loss, ill-defined descriptions and complications of heart disease, internal derangement of knee, iron deficiency anemia secondary to blood loss, keratoconjunctivitis sicca, keratoconjunctivitis, noninfectious, major depressive disorder, mixed hyperlipidemia, morbid obesity, neurological disorders due to brain damage, nonspecific findings on examination of blood, other disorders of stomach and duodenum, other hypertensive complications, pneumonitis due to inhalation of food or vomitus, poisoning by water, mineral, and uric acid metabolism drugs, posttraumatic wound infection, retinal hemorrhage/ischemia, rhabdomyolysis, sensorineural hearing loss, spondylosis without myelopathy, unequal leg length (acquired), urethritis and urethral syndrome, varicose veins, varicose veins of lower extremity, venous embolism & thrombosis, viral hepatitis, voice disturbance