rs17157914 chr7:29408804 G>A
- Sequence
tgttttcaaagaggaacggaagag[G/A]aaagtcatcctaatacattcagcg
- ASB in cell types
- neutrophils from periferal blood MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.26 | 0.28 | 1.50 | |||
| MS-1 (Small cell lung carcinoma) | -0.40 | 0.39 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, hdl cholesterol, irritible bowel syndrome, major depressive disorder, simpson-angus scale, waist hip ratio