rs17160248 chr7:104231667 G>A
- Sequence
tcccgagagctgctcacatcacaa[G/A]gaaaggacccagaatgtgccttgc
- ASB in cell types
- spleen foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 2.33 | -2.17 | 1.00 | |||
| foreskin keratinocyte | 0.93 | n/a | 2.83 |
Items per page:
1 – 2 of 2