rs17160763 chr1:147892908 G>A
- Sequence
gctgatcatgccatctagtggtag[G/A]agtgcagcatgactccaaaaggaa
- ASB in cell types
- KMS-11 (Plasma cell myeloma) GM18486 (Lymphoblastoid Cell Lines) epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | n/a | 0.96 | 6.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.67 | -0.24 | 1.00 | |||
| epidermal keratinocytes | 2.60 | 0.60 | 2.00 |
Items per page:
1 – 3 of 3