rs17160772 chr7:139118277 G>C
- Sequence
attgagccatatgaacctgttgaa[G/C]caccgatcagagagggaagcagaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | -0.38 | 2.26 | 2.25 | n/a | No Hit |
Items per page:
1 – 1 of 1