rs17160967 chr7:139500040 C>T
- Sequence
agggcacccaatgatgctccccac[C/T]agggcccggatgaggtgcactgtg
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 2.13 | -2.61 | 2.00 | |||
| K562 (myelogenous leukemia) | 0.41 | 0.16 | 1.49 |
Items per page:
1 – 2 of 2