rs17162257 chr1:26602511 T>G
- Sequence
gctttccaacattttgcctcttct[T/G]tctggttctctgctgttgtttctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HUVEC-C (HUVEC, umbilical vein endothelial cells) liver
- ASB for transcription factors
- STAG1_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.29 | 0.39 | 1.00 | n/a | n/a | |||
| FOXK2_HUMAN | 2.49 | -2.10 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2