rs17164382 chr4:1167402 C>T
- Sequence
ccctgtgccctcggccgcctgcag[C/T]atgagcctgcacaggagcccccga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.21 | -1.47 | 2.00 | |||
| primary B-CLL cells | 2.24 | n/a | 3.00 |
Items per page:
1 – 2 of 2