rs17164589 chr4:1289820 G>T
- Sequence
cgattggtgcaggggcatcggccc[G/T]cccccatcctgctccggccggcgc
- ASB in cell types
- monocytes from periferal blood GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 2.06 | -0.35 | 3.00 | 1.67 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellum, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood