rs17164683 chr7:92657666 C>T
- Sequence
tacagttgaaagatgtctcttatg[C/T]atcaaaccaaacttaacaaaagtt
- ASB in cell types
- Jurkat (T-cells) MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- MYB_HUMAN SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MYB_HUMAN | -0.29 | 2.42 | 1.60 | n/a | No Hit | |||
| SPT5H_HUMAN | -3.22 | 1.64 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), height, infant head circumference, ldl cholesterol, rheumatoid arthritis, systolic blood pressure (sbp), total cholesterol, triglycerides
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid