rs17166205 chr7:94374529 T>A
- Sequence
tttctgtagtagaatgtatgcact[T/A]ataaaacttttctgatctctctct
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 3.11 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), fasting insulin, height, infant head circumference