rs17167955 chr5:135209009 G>A
- Sequence
aggaagatgaataaggcttgaaac[G/A]cgagcccctggcaggctgactcag
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) HepG2 (hepatoblastoma) HCASMC (Human coronary artery smooth muscle cells)
- ASB for transcription factors
- TF65_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.42 | -0.04 | 2.25 | n/a | No Hit | |||
| TCF21_HUMAN | 2.38 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, aortic valve calcium, parkinsons disease, variant creutzfeldt-jakob disease